Polymerase Chain Reaction (PCR) marker-assisted prediction of sex types in 'Sinta' papaya (Carica papaya L.) hybrids and its parental lines
Date
10-2001
Degree
Bachelor of Science in Biology
College
College of Arts and Sciences (CAS)
Adviser/Committee Chair
Ivan Marcelo A. Duka
Co-adviser
Pablito M. Magdalita
Abstract
MERCADO. CHARLES P. University of the Philippines Los Batios, October 2001. Polymerase Chain Reaction (PCR) Marker-Assisted Prediction of Sex Types in *Sinta. Papaya (Carica papaya L.) Hybrids and its Parental Lines.
Adviser: Ivan-Marcelo A. Duka and Co-adviser: Pablito M. Magdalita
Polymerase Chain Reaction (PCR) was employed to predict sex types of Carica papaya L. var. `Sinta' and its parental lines (`Cavite Special' and `Cariflora/Solo' Papaya) at the seedling stage. Three DNA extraction procedures were compared to determine the most reliable and suitable method in extracting DNA samples from young leaves of papaya: Method 1, Graham et al. 1994; Method 2, Doyle and Doyle 1987; and Method 3, Cheung ei a/. 1993. Assessment of the extracted DNA samples based on the success rate, replicability, and consistency of PCR results showed that the CTAB (hexadecyltrimethyl ammonium bromide) procedure of Doyle and Doyle (1987) is the most reliable and suitable procedure which yields a high quality and high molecular weight DNA. Hence it was adapted in succeeding DNA extractions. Four 20-mer oligonucleotide primers were used in PCR amplifications namely: TI -F, TGCTCTTGATATGCTCTCTG; Tl-R, TACCTTCGCTCACCTCTGCA; W I 1-F, CTGATGCGTGTGTGGCTCTA; and WI 1-R, CTGATGCGTGATCATCTACT. T I -F and TI-R produced a 1.300 base pair (bp) PCR product in both females and hermaphrodites while W11-17 and W11-R produced an 800 by PCR product in hermaphrodites only. Thus. hermaphrodites are distinguished to have two distinct bands (1,300 and 800 bp), females have only a single band (800 bp) while males have no band. PCR analysis of the different populations studied predicted 22 females and 23 hermaphrodites in `Sinta' papaya plants. 12 females and 13 hermaphroditic 'Cavite Special' plants. and 14 females and 11 male Tarillora' plants. Prediction was found to be 100% accurate and precise when compared with the sex types based on the morphological marker for the sex types in papaya. Segregation ratios were found to fit the predicted segregation ratios. Results of this study proved that PCR is a quick (2 days) and reliable technique in determining sex types in C papaya prior to the flowering stage.
Language
English
Location
UPLB Main Library Special Collections Section (USCS)
Call Number
Thesis
Recommended Citation
Mercado, Charles P., "Polymerase Chain Reaction (PCR) marker-assisted prediction of sex types in 'Sinta' papaya (Carica papaya L.) hybrids and its parental lines" (2001). Undergraduate Theses. 11317.
https://www.ukdr.uplb.edu.ph/etd-undergrad/11317
Document Type
Thesis